Anatomia cerebral bàsica. Som les nostres connexions (3)

Reflexió inicial

«Cal saber en general que la font del nostre plaer, goig, riure i diversió, a l’igual que la del nostre pesar, ansietat, dolor i llàgrimes, no és altra cosa que el cervell. És aquest òrgan en particular el que ens permet pensar, veure, sentir i diferenciar el que és lleig de la bellesa, el mal del bé, el que és desagradable del que agradable. També el cervell és el seient de la bogeria i el deliri, dels temors i terrors que ens assalten, sovint, a la nit, algunes vegades durant el dia; que aquí també rau la causa de l’insomni i del somnambulisme, dels pensaments que no sortiran a la llum i que moltes vegades són causa de pertorbacions, dels deures oblidats i de les excentricitats».
Hipòcrates (cap al 460-370 ane.)

Tot el que pensem, fem i deixem de fer s’esdevé en el nostre cervell. L’estructura d’aquest òrgan determina les nostres possibilitats, les nostres limitacions i el nostre caràcter; som el nostre cervell.

Al llarg dels segles, els humans, fascinats pel cervell, han intentat comparar les seves funcions recorrent a models basats en els últims avenços tecnològics de cada època. El cervell s’ha comparat a un sistema hidràulic (model grecoromà), un «llibre omnipresent» (model renaixentista, quan a Europa es va descobrir la impremta), Descartes (1596-1650) contemplava el cos i la ment com una màquina, i comparava el cervell amb un orgue d’església. Creia que l’aire, que era impulsat cap als tubs rodons de l’orgue, es corresponia amb les partícules més fines i actives de la sang, «la seu de l’ànima», que entrava a través d’hipotètiques obertures del cervell mitjançant un sistema vascular (els capil·lars glomerulars dels ventricles). A continuació, uns nervis buits distribuïen l’esperit vital pels músculs. El teclat era l’epífisi, que podia enviar l’esperit vital als ventricles per una direcció determinada, de la mateixa manera que les manxes de l’orgue impulsen l’aire cap a determinats tubs.

Durant la primera revolució industrial va ser comparat a un teler, i durant la primera meitat del segle XX a una taula de comandaments com el complex d’habitacions subterrànies plenes d’aparells situat en ple centre de Londres, i des d’on a partir de 1940 Winston Churchill va dirigir les operacions de la Segona Guerra Mundial. Amb la irrupció del telèfon es va implantar una altra analogia: el cervell com una centraleta telefònica, una gran xarxa de línies telefòniques interconnectades, i la consciència era una llarga filera d’operadores telefòniques assegudes davant d’un gran quadre de calvilles, desconnectant i connectant cables contínuament. Al llarg de la segona meitat del segle XX s’ha comparat a un ordinador, una màquina biològica racional que processa informació; si observem la impressionant quantitat de components que posseeix el nostre cervell i veiem com estan connectats entre si, la metàfora de l’ordinador és suggerent (però falsa). Hi ha cent bilions de punts on les neurones entren en contacte entre elles mitjançant les sinapsis. Les neurones estan unides per més de cent mil quilòmetres de fibres nervioses. La quantitat exorbitant de cèl·lules i de contactes funciona d’una manera tan eficient que el nostre cervell amb prou feines té el consum energètic d’una bombeta de quinze watts. Això vol dir que la despesa total d’energia del cervell d’una persona al llarg d’una vida d’uns vuitanta anys no suposaria més que 1.200 euros, segons els preus vigents. Per aquest preu és impossible aconseguir un ordinador amb una vida útil tan llarga. Per 12 euros es pot subministrar energia a mil milions de neurones al llarg de tota la vida! Una fantàstica i eficient màquina dotada de connexions paral·leles i, a més, millor preparada per al processament d’imatges i associacions que qualsevol ordinador.

L’analogia més recent és la d’Internet que connecta milers de milions d’ordinadors. La consciència, segons aquesta representació, és un fenomen «emergent» que sorgeix miraculosament a partir de l’acció col·lectiva de milers de milions de neurones.

Si fem una història de totes les metàfores fetes sobre el cervell, ens adonarem que no hem fet res més que utilitzar com a metàfora el darrer descobriment que el nostre cervell ha enginyat. L’últim producte del nostre cervell és el que utilitzem com a metàfora per al propi cervell.

El cervell pesa únicament al voltant de quilo i mig, i tanmateix és l’objecte més complex del sistema solar. Encara que suposa tan sols el 2 per cent del pes corporal, consumeix un 20 per cent de la nostra energia total (en els acabats de néixer, el cervell consumeix un esbalaïdor 65 per cent de l’energia total del nadó), mentre que un 80 per cent dels nostres gens codifiquen característiques del cervell. Es calcula que dins de la cavitat cranial hi ha cent mil milions de neurones, i un nombre exponencialment major de connexions neuronals i vies nervioses.

cervell_emocions_rao

Esquema del cervell humà on s’indica la ubicació aproximada de les principals estructures relacionades amb les emocions, els sentiments i els processos racionals. La imatge mostra estructures superficials (les escorces) i internes (l’amígdala, l’hipocamp i l’ínsula). Un cas especial és el de l’ escorça cingulada, que es troba a la cara medial del cervell i, per tant, no es pot veure lateralment.

Si agafem un cervell humà amb les mans ens sorprendrà com pesa. Amb uns 1.300 gr el cervell és un òrgan dens. També distingirem immediatament una fissura longitudinal que divideix el cervell en dues meitats conegudes com hemisferis. En el més profund del cervell, els dos hemisferis estan units pel cos callós, un gruixut feix de fibres connectives. L’esponjosa capa exterior visible dels hemisferis, el còrtex cerebral (paraula que significa literalment «escorça»), té un aspecte rugós: és una mena d’embolcall fet de petits turons i valls coneguts anatòmicament com girs i solcs, respectivament.

parts_cervell

lobuls
Vista de la delimitació aproximada dels quatre lòbuls de l’hemisferi esquerra en 3D: Frontal en blau Parietal en groc Temporal en verd Occipital en vermell.

cos_callos                                                           El cos callós

El còrtex es divideix en cinc lòbuls. El lòbul frontal; el lòbul parietal, situat prop de la coroneta; els dos lòbuls temporals, un a cada costat, al costat de les orelles; i el lòbul occipital, a la part de darrere. Cada lòbul està associat amb una sèrie determinada de funcions mentals. Per exemple, sabem que el lòbul frontal és important per a l’autocontrol i el moviment; el lòbul parietal per al processament del tacte i per a controlar l’atenció; i el lòbul occipital està implicat en el processament visual. La mesura en què les diferents funcions mentals estan localitzades en regions concretes del cervell ha estat motiu de debat durant tota la història de la neurologia i se segueix debatent avui en dia.

quatre_lobuls

Penjant de la part posterior del cervell es troba un òrgan en forma de coliflor, el cerebel, que gairebé sembla un minicervell (de fet, cerebel significa «petit cervell»). També consta de dos hemisferis diferents, i sorprenentment conté aproximadament la meitat de les neurones del sistema nerviós central malgrat constituir només el 10 % del volum del cervell. Tradicionalment el cerebel s’associava només amb l’aprenentatge i amb el control motor (és a dir, amb el control dels moviments del cos), però avui sabem que està implicat en moltes funcions, incloses l’emoció, el llenguatge, el dolor i la memòria.

hemisferis_hipolatemRamon_Cajal
Dibuix fet per Santiago Ramón y Cajal de les cèl·lules d’un cerebel de pollastre.

Mantenint el cervell en alt per estudiar la seva part inferior, es pot veure el tronc o tija cerebral, que, projectant-se cap avall es connecta normalment amb la medul·la espinal. El tronc cerebral també es projecta cap amunt, per l’interior del cervell, fins a un punt aproximadament al nivell dels ulls. Amb diferents regions com la medul·la espinal i el pont de Varolio (protuberància anular o senzillament protuberància), el tronc cerebral està associat amb funcions vitals bàsiques com la respiració i el ritme cardíac. Reflexos com esternudar i vomitar també es controlen des del tronc cerebral. Alguns comentaristes es refereixen a aquesta part del cervell com el «cervell reptilià», però aquest és un nom poc apropiat.

Si tallem el cervell en dues meitats per estudiar la seva anatomia interior, descobrirem que posseeix una sèrie de cavitats plenes de fluid conegudes com ventricles, que actuen com a un sistema d’absorció de xocs. També podem veure el mesencèfal, l’estructura superior del tronc cerebral que exerceix un paper important en funcions com els moviments oculars. A sobre i davant del mesencèfal es troba el tàlem, una important estació repetidora que rep i envia connexions amb moltes altres àrees del cervell. Sota el tàlem es troben l’hipotàlem i la glàndula pituïtària, implicats en l’alliberament d’hormones i en la regulació de necessitats bàsiques com la fam i el desig sexual.

tronc_cervell_cerebelventricles_laterals

Els ventricles laterals són en vermell, el tercer i quart ventricles són en blau, el superior i l’inferior, respectivament.

També incrustats en el més profund del cervell estan els ganglis basals, en forma de banya i implicats en l’aprenentatge, les emocions i el control del moviment. A prop trobem també, un a cada costat del cervell, els hipocamps, així anomenats per la paraula grega que designa els cavallets de mar, perquè els primers anatomistes creien que la seva forma era semblant a la d’aquest animal. També aquí, i a cada costat del cervell, es troben uns nòduls en forma d’ametlla anomenats amígdales. Els hipocamps tenen un paper fonamental en la memòria  i les amígdales són importants per a la memòria i l’aprenentatge, especialment quan en elles hi estan implicades les emocions. El nom col·lectiu que reben els hipocamps, les amígdales i altres parts del còrtex relacionades amb ells és el de sistema límbic, que constitueix una important xarxa funcional de les emocions.

La sorprenent complexitat del cervell és en gran part invisible a simple vista. Dins d’aquesta esponjosa estructura hi ha aproximadament 85 mil milions de neurones que estableixen un nombre més que impressionant de connexions (més de cent trilions). Hi ha també un nombre similar de cèl·lules glials), que les investigacions més recents suggereixen que són alguna cosa més que una mena de majordoma, com es creia, sinó que també estan implicades en el processament de la informació. De totes maneres, hem de tenir cura de no ser excessivament reverents respecte a la construcció del cervell, ja que el seu disseny no és en absolut perfecte.

En el còrtex, les neurones es disposen en capes, cadascuna de les quals conté diferents tipus i densitats de neurones. El terme popular per designar els cervells –«matèria grisa»– prové del nom anatòmic de un teixit compost sobretot pel gruix de les cèl·lules neuronals. El còrtex cerebral està fet enterament de matèria grisa, encara que el seu color és més rosaci que gris, almenys quan és viu. Aquesta matèria contrasta amb la «matèria blanca» –molt abundant sota del córtex–, formada en la seva major part per axons neuronals coberts de greix (els axons són la part de la neurona en forma de circell que és important per a la comunicació amb altres neurones). El greix que cobreix els axons és el que dóna la seva aparença blanquinosa a la matèria blanca.

Les neurones es comuniquen unes amb les altres en uns petits espais anomenats sinapsis. És allà on un missatger químic (un «neurotransmissor») és alliberat al final de l’axó d’una neurona, i posteriorment absorbit per la dendrita (una estructura arbòria) de la neurona receptora. Les neurones alliberen neurotransmissors d’aquesta forma quan han estat prou excitades per altres neurones. Aquesta excitació produeix un «potencial d’acció», que és quan un pic d’activitat elèctrica recorre la neurona fent que, finalment, s’alliberi un neurotransmissor. Aquests neurotransmissors, al seu torn, poden excitar o inhibir a les neurones receptores. També poden produir uns canvis més lents i duradors, per exemple alterant la funció d’un gen en la neurona receptora.

Mètodes d’estudi

Tradicionalment, el coneixement de la funció de les diferents àrees neuronals s’obtenia de la investigació sobre pacients amb danys cerebrals. Al segle XIX es van fer avenços molt significatius en aquest sentit, com l’observació que, en la majoria de les persones la funció del llenguatge la controla l’hemisferi esquerre. Alguns pacients, com l’obrer dels ferrocarrils Phineas Gage, van ser especialment influents en aquest camp. L’estudi de les associacions particulars entre una incapacitat i un dany cerebral segueix sent avui dia una important línia d’investigació sobre el cervell. Una diferència important entre la recerca històrica i la moderna és que avui podem utilitzar la tècnica de l’escàner per identificar en quina part concreta del cervell s’ha produït el dany. Abans que existís aquesta tecnologia, els investigadors havien d’esperar a la mort del pacient per realitzar una autòpsia.

Els mètodes moderns d’obtenció d’imatges cerebrals s’utilitzen no només per examinar l’estructura del cervell, sinó també per observar com funciona. És en la nostra comprensió de la funció cerebral on es estan produint els més importants troballes i les polèmiques més apassionades en el camp de la moderna neurociència. Avui, el mètode més utilitzat en aquest tipus d’investigació tant amb pacients com amb persones sanes, és la ressonància magnètica funcional (RMf). Aquesta tècnica explota el fet que la sang està més oxigenada en les parts més actives del cervell. Comparant els canvis en l’oxigenació de la sang a tot el cervell, la RMf pot utilitzar per a visualitzar quines àrees del cervell estan treballant més intensament que d’altres. A més, monitoritzant meticulosament aquests canvis en l’escàner cerebral mentre els subjectes realitzen determinades tasques, la RMf pot contribuir a confeccionar un mapa de quines parts del cervell estan implicades en diferents funcions mentals. Altres formes d’escanejar el cervell són la tomografia per emissió de positrons (PET, per les sigles en anglès) i la tomografia computeritzada d’emissió monofotònica, tècniques que impliquen injectar un isòtop radioactiu al pacient el cervell del qual s’escaneja. Una altra forma d’obtenir imatges cerebrals és la que utilitza un tensor de difusió (DTI), que consisteix a fer passar molècules d’aigua pel teixit neural i que s’utilitza per traçar el mapa dels senders connectius del cervell. La tècnica DTI produeix uns diagrames en color bells i complexos. El Projecte conectoma Humà, iniciat l’any 2009, té com a objectiu traçar el mapa dels 600 trilions de connexions del cervell humà.

Una tècnica més antiga d’obtenció d’imatges cerebrals, utilitzada per primer cop en humans en la dècada de 1920, és l’electroencefalografia (EEG), que consisteix a monitoritzar les ones d’activitat elèctrica mitjançant uns elèctrodes col·locats en el cuir cabellut. Aquesta tècnica s’utilitza encara molt en hospitals i laboratoris. La resolució espacial és pobre comparada amb la que s’obté amb mètodes més moderns com la RMf, però té l’avantatge que les fluctuacions d’activitat poden detectar-se en mil·lisegons (davant els segons que triga en detectar-la RMf). Una tècnica desenvolupada més recentment que comparteix la resolució temporal de l’EEG és la magnetoencefalografia, però que tampoc té una bona resolució espacial.

L’obtenció d’imatges cerebrals no és l’únic mètode que utilitzen els investigadors contemporanis per estudiar el cervell humà. Un altre enfocament que s’ha fet molt popular recentment és l’estimulació magnètica transcranial (EMT). Consisteix a col·locar un dispositiu magnètic sobre una regió del cap que té l’efecte de pertorbar temporalment l’activitat neural en les àrees cerebrals situades sota d’aquest punt. Aquest mètode es pot utilitzar per crear el que es coneix com una “lesió virtual” al cervell. D’aquesta manera els investigadors poden bloquejar temporalment el funcionament d’una àrea específica del cervell i veure després quin efecte ha tingut això en el funcionament mental. Mentre que la RMf mostra on l’activitat del cervell es correlaciona amb la funció mental, l’EMT té l’avantatge que pot mostrar si l’activitat en una zona determinada és necessària perquè es produeixi la funció mental corresponent.

Les tècniques fins ara esmentades poden utilitzar-se en humans i en animals. Hi ha també un tipus d’investigacions cerebrals que només es fan amb animals, perquè utilitzen tècniques considerades massa invasives per ser aplicades a un ésser humà. En moltes de les investigacions que es fan amb micos i altres primats no humans s’utilitza una tècnica que consisteix a inserir elèctrodes al cervell i registrar directament l’activitat de determinades neurones (single-cell recording). Aquest mètode només s’utilitza rarament en humans, per exemple durant una intervenció quirúrgica en un pacient amb epilèpsia severa. La inserció directa d’elèctrodes i cànules en cervells d’animals pot utilitzar-se també per monitoritzar i modificar els nivells de concentració de neurotransmissors en punts molt localitzats. Una altra tècnica innovadora que s’utilitza actualment en la investigació amb animals és l’optogenètica. Qualificada en 2010 de “mètode de l’any” per la revista Nature Methods, l’optogenètica implica la inserció de gens fotosensibles en les neurones. Aquestes neurones poden així ser activades i desactivades exposant-les a diferents colors de llum.

Constantment s’estan desenvolupant nous mètodes per investigar el cervell, i les innovacions en aquest camp s’acceleraran en els pròxims anys gràcies a la posada en marxa d’iniciatives com la BRAIN INITIATIVE nord-americana i el HUMAN BRAIN PROJECT de la Unió Europea.

Què són els gens, què fan i com funcionen

Els gens són segments discrets del material hereditari que porten codificat un missatge específic, una instrucció de funcionament. Per exemple, tots tenim un parell de gens que indica quin ha de ser el nostre grup sanguini –A, B, AB o 0–. El suport físic d’aquesta informació són les cadenes d’ADN –àcid desoxiribonucleic– que es troben a l’interior del nucli de totes les cèl·lules del nostre cos. L’ADN es presenta associat a un conjunt de proteïnes que li serveixen de bastida, li confereixen estabilitat i contribueixen a la regulació del funcionament dels gens que conté. El conjunt format per l’ADN i aquestes proteïnes constitueix els cromosomes –per ser més precisos, la cromatina.

cellula_genADN_gensADN, gens i cromosomes. El cos humà està format per uns deu mil milions de cèl·lules. cadascuna de les quals té tots els gens que caracteritzen la nostra espècie, és a dir, tot el genoma.

Les cadenes d’ADN es formen per la unió lineal d’unes molècules més senzilles, anomenades nucleòtids. Hi ha quatre nucleòtids diferents, que es coneixen per la inicial del seu nom: A (adenina), T (timina), G (guanina) i (citosina). La informació que contenen els gens es codifica segons l’ordre dels nucleòtids que els formen. Així, per exemple, la seqüència de nucleòtids:

GGGCGCTCCCGGAGTATCAGCAAAAGGGTTCGCCCCGCCCACAGTGCCCG

correspon a l’inici d’un gen humà anomenat MAO-A, que conté la informació per elaborar un enzim implicat en aspectes concrets de l’agressivitat humana. En canvi, la seqüència:

CTGATGAAATGAACGAGACAGTCAGAGAGCTACTCCATTCCCGTGGAAAC

correspon als cinquanta primers nucleòtids d’un altre gen humà, l’anomenat HTR2A, que porta la informació necessària per a elaborar una proteïna que actua com a receptora per a un neurotransmissor, una molècula que té a veure amb l’activitat neural que es troba implicada en aspectes de l’agressivitat humana.

El conjunt de tots els gens d’un individu és el seu genoma. Les persones tenim uns 24.000 gens, la majoria dels quals duplicats: un prové de la mare i l’altre del pare. Totes les cèl·lules del nostre cos, uns deu mil milions, contenen el genoma complet, però no tots els gens funcionen simultàniament en qualsevol cèl·lula. Cada cèl·lula expressa –fa funcionar– un conjunt concret de gens, els que necessita per mantenir-se i realitzar les funcions que li corresponen en el conjunt de l’organisme. Per saber quins gens han de funcionar i amb quina intensitat, el genoma disposa d’unes zones reguladores que actuen com a interruptor.

¿De què serveix la informació que emmagatzemen els gens? La major part dels gens porten la informació necessària per elaborar una proteïna, com l’enzim codificat pel gen MAO-A o el receptor de neurotransmissors codificat pel gen HTR2A, els exemples que hem esmentat anteriorment. D’altra banda, totes les persones tenim els mateixos 24.000 gens, però poden presentar subtils diferències. Això es veu amb claredat en els grups sanguinis. Tothom té una parella de gens heretats de la mare i el pare, respectivament, que indiquen quin ha de ser el nostre grup sanguini, però aquest pot ser diferent, de la mateixa manera que no tots tenim el mateix color de pèl o d’ulls, ni responem amb el mateix grau d’agressivitat davant d’una situació que percebem com a amenaça. Tot això es deu a lleus diferències en la seqüència dels gens implicats, és a dir, a l’existència de diverses variants gèniques d’un mateix gen, unes variants que, en terminologia genètica, es denominen al·lels. L’existència d’aquestes variants gèniques també és responsable que hi hagi persones rosses, morenes i pèl-roges, amb els ulls de color marró, blau o verd, més altes o més baixes, que puguin pair bé el gluten o que siguin intolerants a ell, etc. Aquestes subtils diferències tenen implicacions pel que fa a les emocions i conducta de les persones.

En el grup sanguini, però, no hi ha cap intervenció de l’ambient: el que diuen els gens és el que es manifesta, sense cap concessió. No passa el mateix amb l’altura. L’alçada de les persones no depèn d’un únic gen, sinó de diversos gens que interactuen entre ells i contribueixen a aquest mateix caràcter; cada un d’ells fa la seva aportació particular a l’altura total de la persona, més o menys en funció de cada variant gènica, i el conjunt es veu modulat, a més, per l’ambient. Així, per exemple, si el conjunt de variants gèniques que determinen l’altura marquen una variable entre 1,60 i 1,70 m però l’alimentació és deficitària en la infància i l’adolescència, la persona es quedarà a la part inferior d’aquest interval , i si l’alimentació és rica i equilibrada, segurament arribarà al màxim que li permetin els seus gens. Doncs bé, amb caràcters del comportament, l’efecte contributiu i relacional de nombrosos gens, cadascun amb les variants gèniques corresponents, i el de l’ambient, és encara molt més acusat. Per això cal parlar d’heretabilitat.

Hi ha algunes característiques hereditàries fàcils d’observar:

–  si es pot o no doblegar la llengua en forma de U.

llengua

– si es té el lòbul de l’orella separat o enganxat a la galta.

orella    – si s’és capaç de flexionar el dit polze cap enreredit_gros    – si el dit índex és més llarg o més curt que l’anular

dit_indexQuè en sabem de com funciona el cervell

Gairebé tot es decideix des que el nadó està en el ventre de la mare i fins que té quatre o cinc anys. En el moment de néixer el cervell té aproximadament un 25% de la mida i del pes del d’un adult, cap al primer any ja té, aproximadament, el 50 per cent, i als dos anys ja té el 75 per cent. Som, doncs, bàsicament context.

En un sol mil·límetre cúbic del nostre cervell hi ha unes 40.000 neurones i 1.000 milions de connexions de fibres nervioses. A cada connexió es transmeten trens d’impulsos elèctrics variables en intensitat i intervenen més de 30 productes químics diferents. Les neurones més grans arriben a tenir més de 60.000 connexions amb altres 600 neurones. Es calcula que en tot el cervell, el nombre de neurones està entre 15 i 33 bilions, amb més de 100 bilions de connexions (10 elevat a la 14) o per entendre-ho millor, 100 milions de vegades un milió i si es posessin en línia recta totes les fibres nervioses, abastarien una longitud de 400.000 quilòmetres.

sinapsi

Esquema d’una sinapsi química entre un axó d’una neurona i la dendrita d’un altre. Les sinapsis són espais diminuts especialitzats entre les neurones. Els impulsos elèctrics que arriben a la terminal de l’axó desencadenen l’alliberament de missatgers químics (neurotransmissors), que es difonen a través de l’escletxa sinàptica fins a trobar els receptors de la dendrita adjacent. Quan s’uneixen, causen canvis en la cèl·lula receptora que desencadenen, de forma general, un altre impuls nerviós. Un cop el neurotransmissor s’allibera del lligam amb el receptor, és metabolitzat o és tornat a internalitzar en una neurona per ser reutilitzat.

El nostre cervell està compost per cèl·lules anomenades neurones i glies: centenars de milers de milions. Cadascuna d’aquestes cèl·lules és tan complicada com una ciutat. I cadascuna d’elles conté tot el genoma humà i fa circular milers de milions de molècules en intricades economies. Cada cèl·lula envia impulsos elèctrics a altres cèl·lules, en ocasions fins a centenars de vegades per segon. Si es representés aquests milers i milers de bilions de polsos en el cervell mitjançant un sol fotó de llum, el resultat que s’obtindria seria encegador.

Les cèl·lules es connecten unes a les altres en una xarxa de tan sorprenent complexitat que el llenguatge humà resulta insuficient i es necessiten noves expressions matemàtiques. Una neurona típica porta a terme unes deu mil connexions amb les seves neurones adjacents. Tenint en compte que disposem de milers de milions de neurones, això vol dir que hi ha tantes connexions en un sol centímetre cúbic de teixit cerebral com estrelles de la galàxia de la Via Làctia.

Les innombrables facetes del nostre comportament, pensaments i experiències van inseparablement lligades a una immensa xarxa electroquímica anomenada sistema nerviós. La intel·ligència és un subproducte de la relació social. El que ens fa intel·ligents és el contacte amb els altres, és l’haver d’intuir el que està pensant o cavil·lant el cervell del que tinc davant; no sigui que em vulgui ajudar i no sàpiga com, no sigui que em vulgui manipular i ho sàpiga massa bé.

Som les nostres connexions.

Les veus, els pensaments se sustenten en un element físic. Ho sabem perquè les alteracions del cervell canvien els pensaments que tenim. Les nostres esperances, somnis, aspiracions, pors, instints, grans idees, fetitxes, el sentit de l’humor, els desitjos, emergeixen d’aquest estrany òrgan, i quan el cervell canvia, nosaltres també.

Tot depèn directament de la integritat d’aquest enigmàtic centre de control d’un quilo dos-cents grams de pes.

Gairebé tot el que fem, pensem i sentim no està sota el nostre control conscient. Els immensos laberints neuronals apliquen els seus propis programes. El tu conscient –aquest jo que a poc a poc torna a la vida quan es desperta al matí– és el fragment més petit del que passa en el nostre cervell. Encara depenem del funcionament del cervell per a les nostres vides interiors, ell actua pel seu compte. Gairebé totes les seves operacions queden fora de l’acreditació de seguretat de la ment conscient.

Lectures de referència

Damasio, Antonio R. (2010). Y el cerebro creó al hombre : ¿cómo pudo el cerebro generar emociones, sentimientos, ideas y el yo? Barcelona. Destino. (Col. Imago Mundi). 1ª impr. Pàgs. 445-471.

Eagleman, David (2014). Incógnito: las vidas secretas del cerebro. Barcelona. Anagrama. (Col. Argumentos, 449). 4ª impr.  Pàgs. 9-14.

Goldberg, Elkhonon (2015). El cerebro ejecutivo : lóbulos frontales y mente civilizada. Barcelona. Crítica. (Col. Drakontos). Pàgs. 53-101.

González Álvarez, Julio (2010). Breve historia del cerebro. Barcelona. Crítica. (Col. Drakontos). 1ª impr. Pàgs. 65-266.

Grah, Gunnar i Kumar, Arvind: «Historia del cerebro en metáforas». Investigación y Ciencia. Mente y Cerebro. Marzo/Abril 2015, Nº 71.

Jarret, Christian (2015) Grandes mitos del cerebro. Vilassar de Dalt. Ediciones de Intervención Cultural. Biblioteca Buridán. Pàgs. 23-27.

Jensen, Eric (2010). Cerebro y aprendizaje : competencias e implementación educativas. Madrid. Narcea. (Col. Educación hoy. Estudios,96). Pàgs. 15-16.

Kaku, Michio (2014). El futuro de nuestra mente: el reto científico para entender, mejorar, y fortalecer nuestra mente. Barcelona. Debate. Pàgs. 35-69.

Seung, Sebastian (2012). Conectoma. Barcelona. RBA. Pàgs. 11-23

Swaab, Dick (2014). Somos nuestro cerebro. Barcelona. Plataforma editorial. pàgs. 27-37.

Dr. Joan Campàs   Aura digital
Estudis d’Arts i Humanitats de la UOC

Curs Som les nostres connexions
Material en format pdf

Tema 0. Presentació i justificació
Tema 1. El cervell ens enganya

Tema 2. El cervell també enganya l’autopercepció del cos
Tema 3. Anatomia cerebral bàsica
Tema 4. Mite: Només utilitzem el 10 % del nostre cervell
Tema 5. Mite: L’homosexualitat (l’hetero, la bi, la trans) és una elecció
Tema 6. Mite: Els fills hereten la intel·ligència dels pares
Tema 7. Mite: Internet i els videojocs són addictius
Tema 8. Mite: El cervell és un ordinador
Tema 9. La memòria
Tema 10. Com definir el «jo»? El cervell i la «joïtat»
Tema 11. L’evolució del cervell (1)
Tema 12. L’evolució del cervell (2)
Tema 13. L’evolució del cervell (3)
Tema 14. L’evolució del cervell (4)
Tema 15. Cervell humà i evolució

Conjunt dels posts amb les introduccions fetes al facebook
Som les nostres connexions

Deixa un comentari

L'adreça electrònica no es publicarà Els camps necessaris estan marcats amb *


*